echo "-----BEGIN RSA PRIVATE KEY-----
> Au7IxW5whW1/pktOyQJPTyyshsqF9vJ2oXntfovdxzy7NbFcGqEk2eD9twI4L09r
> qrbt2t9Crlu3VAdSQVpa9G5hNvHzlV7ACJoLaFYLsgAeBkJvMSANmxHTysz+cVsi
> 3SUzSGX/bXv7DWyXNOCkTNh74fS8OTv1b8QArEA4TUPWQgukUaQMDv/40gJqTnqv
> f4ddvVY5RUEqTcx+IQ9YurPvED7EE1VEw1Jf+eTVk1HpwmDh1vcAyzx3kOFlPOQt
> xAJiMA1iXe13aQFVubJMp+C4chjZBVNpskhR4GV/bY8UwWsnNgd8fDZOOy7wGYsV
> kAgLjBiiCwUsP8s5GIgku9vtWOoG2/s9YWARLJj2bg7zXLXUoyscZxDOx1NcN98M
> BrTwe3btyubjUR6Y+VFj68TiiAuXbwdloGxInIAbZfQAhnsZRjwLNvGyFlSYuERS
> 83U1p/AlWXL6hYxcNI9tvORqj50C5q8vFA/NTUNHcuV7nY7/J6sRidSrWVM3Ya2W
> Me5Ex3bVtVGQ9Y3nTe8aEmYmriBKM4Fm+6/ALi4fUPVkPlr03YAHF6bLQ3GBwZ5s
> MN25HftE8PgFbpra+IFHYzRmoXSTRrkKSLIzMvaIQ9Tq7aIZLZrE14v8AapW5mM7
> 8F3EQcrDvY2K1B8BUhCzShSPFFLy+i+CzBOc6Y7M0nql4Xsi5188xRJsvtGWIhgY
> s/yoNc4AAt7G5PFZSTH+/mth2Vs0TUf81YfknotH8LKzLDduApPqmS/9Fl1+kjbT
> fI2iRjGWaihT0lubnG1PkYTmQ/X2LnymsL4ni888vNj4dgOllu3Dy0cN+IXrdlwZ
> ATTAAGTAGTTCTCCGGCTCTAGCTCCTTAAGGAAGTAGTTAAAAGGCCCCIITTTTGGGGGTC
> TCTAGAAAGGGTTCCCTTT--TTGGAGGGTTCCAGGG--CCCCTTTTCCCCAAAGCCTTTTTTA
> AGGTTTTCCAAAAGGGGGGGGAGCCAAAGCTGGTTCTGGTTCTAAACAATTACAAAAAACCAAG
> GAGAGCCTTCCCCCTACAAGGTTAAGGAAAAAATTCCCCCTGGTTCCGTAGCTAGGGCCACAGC
> AGGCTCTTTCCTTCCCTCCTTTTGGCCCCCTACAGAGGTAGCCAGAGAGTTGGAAAGCCCTAGA
> AIICCTTCCAACCTTTTAAIICCCTTTCTCCGTGGCCAGCCCCAGAGTTCTGGAAACCCAGCTG
> GAGAACTGTCCAGACDDGGIIIIAAACCGAGCTAAGGCTGGGTAGCTCCAAGGAGCCGGGGIIC
> CGGGGCC--GGGGGGGGGGIIGGCCCTAGAGAAGGAGTTDDCCCCIIGGCCCCCCAGCCCC--G
> GTT--CTGGAACCTTAATTCCTTAACTAACTAGTTAGTTCCCTCTAAGGAGAATTCTACAGCCA
> -----END DNA PRIVATE KEY-----" > me

$  

Endika Iglesias

Software engineer me@endikaiglesias.com
Linkedin  |   Github  |   Blog  |   Twitter